Transcript: Mouse XM_006523060.2

PREDICTED: Mus musculus microrchidia 3 (Morc3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Morc3 (338467)
Length:
4133
CDS:
351..2972

Additional Resources:

NCBI RefSeq record:
XM_006523060.2
NBCI Gene record:
Morc3 (338467)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523060.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321748 GTGATGTTTACCGACCTAAAT pLKO_005 1003 CDS 100% 13.200 18.480 N Morc3 n/a
2 TRCN0000321687 GCAGCGTAATAGCGAACTTAG pLKO_005 3124 3UTR 100% 10.800 15.120 N Morc3 n/a
3 TRCN0000026918 CCAGTTGGATTGTACGGGAAT pLKO.1 429 CDS 100% 4.050 5.670 N Morc3 n/a
4 TRCN0000321814 CAGTGATTAGTGACCATATAT pLKO_005 211 5UTR 100% 15.000 12.000 N Morc3 n/a
5 TRCN0000363378 ACACCGTCAGATGATTAATTT pLKO_005 599 CDS 100% 15.000 10.500 N Morc3 n/a
6 TRCN0000321815 CCTTTGCAGCAAGGATTATAA pLKO_005 1708 CDS 100% 15.000 10.500 N Morc3 n/a
7 TRCN0000321749 AGCGAGATCAGCAGTACTTAA pLKO_005 2952 CDS 100% 13.200 9.240 N Morc3 n/a
8 TRCN0000378604 GATTTAGTGCATCCTACTTAT pLKO_005 1509 CDS 100% 13.200 9.240 N Morc3 n/a
9 TRCN0000026932 GCATTCATGTTGACCTTGTAA pLKO.1 1984 CDS 100% 5.625 3.938 N Morc3 n/a
10 TRCN0000026900 GCCTACATTGAACGTGATGTT pLKO.1 990 CDS 100% 4.950 3.465 N Morc3 n/a
11 TRCN0000026930 CGCTTGTCTAAAGTGGCGAAA pLKO.1 1385 CDS 100% 4.050 2.835 N Morc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523060.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.