Transcript: Mouse XM_006523104.3

PREDICTED: Mus musculus RIKEN cDNA 4932438H23 gene (4932438H23Rik), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
4932438H23Rik (74387)
Length:
6904
CDS:
671..1363

Additional Resources:

NCBI RefSeq record:
XM_006523104.3
NBCI Gene record:
4932438H23Rik (74387)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523104.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174888 GTCATACAGTATTGACAACAT pLKO.1 1249 CDS 100% 4.950 6.930 N 4932438H23Rik n/a
2 TRCN0000194540 GAAATACCATTCGCAACTGCA pLKO.1 831 CDS 100% 2.640 2.112 N 4932438H23Rik n/a
3 TRCN0000176097 GAAGCTATGTTGTCACAGTTA pLKO.1 1335 CDS 100% 4.950 3.465 N 4932438H23Rik n/a
4 TRCN0000173296 GCAACAGAAGCTATGTTGTCA pLKO.1 1329 CDS 100% 0.300 0.210 N 4932438H23Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523104.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.