Transcript: Mouse XM_006523216.3

PREDICTED: Mus musculus zinc finger, DHHC domain containing 14 (Zdhhc14), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zdhhc14 (224454)
Length:
2513
CDS:
1046..2278

Additional Resources:

NCBI RefSeq record:
XM_006523216.3
NBCI Gene record:
Zdhhc14 (224454)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179195 GTGCATTCAGAGCACCAAATT pLKO.1 2311 3UTR 100% 13.200 9.240 N ZDHHC14 n/a
2 TRCN0000125756 CCGTGAAACTAAAGTACTGTT pLKO.1 1527 CDS 100% 4.950 3.465 N Zdhhc14 n/a
3 TRCN0000125757 CCTGTCCTTTCTGACAGTCTT pLKO.1 1693 CDS 100% 0.495 0.347 N Zdhhc14 n/a
4 TRCN0000125758 CAGTGCATTCAGAGCACCAAA pLKO.1 2309 3UTR 100% 4.950 2.970 N Zdhhc14 n/a
5 TRCN0000125755 CCCAGGAAGAAACAAGTTCTT pLKO.1 1174 CDS 100% 0.495 0.297 N Zdhhc14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.