Transcript: Mouse XM_006523249.3

PREDICTED: Mus musculus tubby like protein 4 (Tulp4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tulp4 (68842)
Length:
10999
CDS:
1935..6707

Additional Resources:

NCBI RefSeq record:
XM_006523249.3
NBCI Gene record:
Tulp4 (68842)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523249.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103454 CGGAGACATCAGCTTAATGAA pLKO.1 2726 CDS 100% 5.625 7.875 N Tulp4 n/a
2 TRCN0000302647 CGGAGACATCAGCTTAATGAA pLKO_005 2726 CDS 100% 5.625 7.875 N Tulp4 n/a
3 TRCN0000374989 TGCCTTCATTCCCACTATTAA pLKO_005 3164 CDS 100% 15.000 12.000 N Tulp4 n/a
4 TRCN0000103453 GCGGCCAGAGTTTGTCATTAT pLKO.1 3374 CDS 100% 13.200 9.240 N Tulp4 n/a
5 TRCN0000374928 TGACACTGACTCGGATGATTA pLKO_005 2624 CDS 100% 13.200 9.240 N Tulp4 n/a
6 TRCN0000103451 CCCAACAACATGCGAGACTTT pLKO.1 3201 CDS 100% 4.950 3.465 N Tulp4 n/a
7 TRCN0000302575 CCCAACAACATGCGAGACTTT pLKO_005 3201 CDS 100% 4.950 3.465 N Tulp4 n/a
8 TRCN0000103452 CGGAGGAATCTTTGTGTGGAT pLKO.1 2243 CDS 100% 2.640 1.848 N Tulp4 n/a
9 TRCN0000103450 CCAGTCAATATCACTTGATTA pLKO.1 9271 3UTR 100% 13.200 6.600 Y Tulp4 n/a
10 TRCN0000302574 CCAGTCAATATCACTTGATTA pLKO_005 9271 3UTR 100% 13.200 6.600 Y Tulp4 n/a
11 TRCN0000016977 CCAACTGAAGTCAAAGAAGTT pLKO.1 6242 CDS 100% 4.950 2.475 Y TULP4 n/a
12 TRCN0000016973 GCTAGGACTTTGAGTGACTTT pLKO.1 6159 CDS 100% 4.950 2.475 Y TULP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523249.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.