Transcript: Mouse XM_006523257.3

PREDICTED: Mus musculus transmembrane protein 181A (Tmem181a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem181a (77106)
Length:
4494
CDS:
80..1627

Additional Resources:

NCBI RefSeq record:
XM_006523257.3
NBCI Gene record:
Tmem181a (77106)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523257.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190369 CGGAAACTTTCAGGGCATGAA pLKO.1 1141 CDS 100% 4.950 2.475 Y Tmem181a n/a
2 TRCN0000201427 CGTGATTTACGGGAGTGACTA pLKO.1 1537 CDS 100% 4.950 2.475 Y Tmem181a n/a
3 TRCN0000192905 GCAAAGGTTTCCTGTTCCTTA pLKO.1 1724 3UTR 100% 4.950 2.475 Y Tmem181a n/a
4 TRCN0000191505 GCTAGTTATTAGCATCGTCAT pLKO.1 1297 CDS 100% 4.050 2.025 Y Tmem181a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523257.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.