Transcript: Mouse XM_006523260.2

PREDICTED: Mus musculus synaptotagmin-like 3 (Sytl3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sytl3 (83672)
Length:
2426
CDS:
687..2129

Additional Resources:

NCBI RefSeq record:
XM_006523260.2
NBCI Gene record:
Sytl3 (83672)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234013 AGAAAGTGCAATCCGTATGTC pLKO_005 1704 CDS 100% 4.950 6.930 N Sytl3 n/a
2 TRCN0000234012 CGGAAGCTTAATTAGCATCAA pLKO_005 1538 CDS 100% 4.950 6.930 N Sytl3 n/a
3 TRCN0000218533 TTGAGACACGGAAGCTTAATT pLKO_005 1530 CDS 100% 15.000 12.000 N Sytl3 n/a
4 TRCN0000234015 TCGAGGAAACCTTGAAGTATC pLKO_005 1804 CDS 100% 10.800 7.560 N Sytl3 n/a
5 TRCN0000379411 TAAGGACAGTACGGCACAGAA pLKO_005 1943 CDS 100% 4.950 3.465 N Sytl3 n/a
6 TRCN0000234014 TGGACCCGACTTTCGAGGAAA pLKO_005 1792 CDS 100% 4.950 3.465 N Sytl3 n/a
7 TRCN0000382306 ACAGAATGCCAGATGGTATCC pLKO_005 1958 CDS 100% 4.050 2.835 N Sytl3 n/a
8 TRCN0000381011 GTGTTCCTCGGAGAAGTGATC pLKO_005 1899 CDS 100% 4.050 2.835 N Sytl3 n/a
9 TRCN0000093154 GCCATTCATTACTGCGTTAAA pLKO.1 1620 CDS 100% 13.200 6.600 Y Sytl3 n/a
10 TRCN0000093158 TGCCATTCATTACTGCGTTAA pLKO.1 1619 CDS 100% 10.800 5.400 Y Sytl3 n/a
11 TRCN0000093156 CGGTTTGCTTTGAGGACAGAA pLKO.1 997 CDS 100% 4.950 2.475 Y Sytl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.