Transcript: Mouse XM_006523372.1

PREDICTED: Mus musculus predicted gene 3435 (Gm3435), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm3435 (100041621)
Length:
1509
CDS:
115..1407

Additional Resources:

NCBI RefSeq record:
XM_006523372.1
NBCI Gene record:
Gm3435 (100041621)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523372.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270020 CAATACCCTGTCAGAATATAT pLKO_005 1427 3UTR 100% 15.000 9.000 N Gm3435 n/a
2 TRCN0000269949 CCTCGTATCCGGGATCATTTA pLKO_005 1186 CDS 100% 13.200 6.600 Y 9030025P20Rik n/a
3 TRCN0000270016 CTTTAGTGCATGACTTGATTT pLKO_005 134 CDS 100% 13.200 6.600 Y 9030025P20Rik n/a
4 TRCN0000270021 GTATACCACGTTTGATGAAAT pLKO_005 1062 CDS 100% 13.200 6.600 Y Gm3435 n/a
5 TRCN0000269953 TCCTCGTATCCGGGATCATTT pLKO_005 1185 CDS 100% 13.200 6.600 Y Gm3435 n/a
6 TRCN0000270022 TGCTGTGATGGACATACTAAA pLKO_005 591 CDS 100% 13.200 6.600 Y Gm3435 n/a
7 TRCN0000270019 TATGAGGTACTGTCAGCATTA pLKO_005 841 CDS 100% 10.800 5.400 Y Gm3435 n/a
8 TRCN0000269950 TGATATCAATAGCATTGTAAC pLKO_005 186 CDS 100% 10.800 5.400 Y 9030025P20Rik n/a
9 TRCN0000197451 CCTTTAGTGCATGACTTGATT pLKO.1 133 CDS 100% 5.625 2.813 Y Ermard n/a
10 TRCN0000176995 GAGTTGTTTCTTGAGATACTT pLKO.1 403 CDS 100% 5.625 2.813 Y Ermard n/a
11 TRCN0000177327 GCTCAGTTTGAAATTCAGTAT pLKO.1 352 CDS 100% 4.950 2.475 Y Ermard n/a
12 TRCN0000178106 GTGGACAACTTATCCAGAGTT pLKO.1 387 CDS 100% 4.950 2.475 Y Ermard n/a
13 TRCN0000176654 CGTTTGATGAAATACTGGCAA pLKO.1 1070 CDS 100% 2.640 1.320 Y Ermard n/a
14 TRCN0000176496 CTTGATTTGTAACCTTGGGTT pLKO.1 147 CDS 100% 2.640 1.320 Y Ermard n/a
15 TRCN0000200453 GCAATTACTGACCGTGTGAGA pLKO.1 232 CDS 100% 2.640 1.320 Y Ermard n/a
16 TRCN0000177144 GATATGAAGAATTAGGGCGAA pLKO.1 251 CDS 100% 2.160 1.080 Y Ermard n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523372.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.