Transcript: Mouse XM_006523439.3

PREDICTED: Mus musculus catsper channel auxiliary subunit delta (Catsperd), transcript variant X17, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Catsperd (106757)
Length:
2805
CDS:
118..1848

Additional Resources:

NCBI RefSeq record:
XM_006523439.3
NBCI Gene record:
Catsperd (106757)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523439.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197387 CTCTAAGTACAAACTGGATAT pLKO.1 1623 CDS 100% 10.800 15.120 N Catsperd n/a
2 TRCN0000178232 GACATAGCTGACAAGACACTT pLKO.1 1732 CDS 100% 4.950 6.930 N Catsperd n/a
3 TRCN0000216779 GGTTTAAGGCAAACCTCAATG pLKO.1 1577 CDS 100% 1.080 0.756 N Catsperd n/a
4 TRCN0000198043 CGCTTCAACCATGTAATGTCA pLKO.1 1418 CDS 100% 3.000 2.100 N Catsperd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523439.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.