Transcript: Mouse XM_006523520.2

PREDICTED: Mus musculus baculoviral IAP repeat-containing 6 (Birc6), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Birc6 (12211)
Length:
15837
CDS:
21..14864

Additional Resources:

NCBI RefSeq record:
XM_006523520.2
NBCI Gene record:
Birc6 (12211)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523520.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369112 ATTGGATGGTTACGGTTATTA pLKO_005 10266 CDS 100% 15.000 21.000 N BIRC6 n/a
2 TRCN0000037330 GCACTATGTAATAGACGTAAA pLKO.1 2523 CDS 100% 10.800 15.120 N Birc6 n/a
3 TRCN0000308333 GCACTATGTAATAGACGTAAA pLKO_005 2523 CDS 100% 10.800 15.120 N Birc6 n/a
4 TRCN0000037331 CCTCTGATTCTACAATAGATA pLKO.1 10564 CDS 100% 5.625 4.500 N Birc6 n/a
5 TRCN0000308401 CCTCTGATTCTACAATAGATA pLKO_005 10564 CDS 100% 5.625 4.500 N Birc6 n/a
6 TRCN0000304959 TGTCGTCAGTGGTGGATATTT pLKO_005 2657 CDS 100% 15.000 10.500 N Birc6 n/a
7 TRCN0000037329 CCCACAAGATAGGGTCTTTAT pLKO.1 6611 CDS 100% 13.200 9.240 N Birc6 n/a
8 TRCN0000004159 GCTGTAGTGAATGGTGCAAAT pLKO.1 2565 CDS 100% 10.800 7.560 N BIRC6 n/a
9 TRCN0000037333 CCCTATGCAAATGGCTGCTTT pLKO.1 14148 CDS 100% 4.950 3.465 N Birc6 n/a
10 TRCN0000037332 CCAGCAAATTATGAGCCAGAT pLKO.1 9245 CDS 100% 4.050 2.835 N Birc6 n/a
11 TRCN0000308332 CCAGCAAATTATGAGCCAGAT pLKO_005 9245 CDS 100% 4.050 2.835 N Birc6 n/a
12 TRCN0000304958 CATATCTTCATGCTCATATTT pLKO_005 15311 3UTR 100% 15.000 9.000 N Birc6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523520.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.