Transcript: Mouse XM_006523588.2

PREDICTED: Mus musculus dynein, axonemal, heavy chain 8 (Dnah8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dnah8 (13417)
Length:
14959
CDS:
131..14326

Additional Resources:

NCBI RefSeq record:
XM_006523588.2
NBCI Gene record:
Dnah8 (13417)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523588.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100387 CCCTCGCATAAATACATATTT pLKO.1 644 CDS 100% 15.000 21.000 N Dnah8 n/a
2 TRCN0000100385 GCCGTCATAAATGTGCTAAAT pLKO.1 1457 CDS 100% 13.200 10.560 N Dnah8 n/a
3 TRCN0000100388 CGGTACATGATTGGTGAAGTA pLKO.1 13175 CDS 100% 4.950 3.960 N Dnah8 n/a
4 TRCN0000100389 CCTGGAAATCAATCACACAAT pLKO.1 2278 CDS 100% 4.950 3.465 N Dnah8 n/a
5 TRCN0000100386 CGTGTATATTTACGGGCTGTA pLKO.1 14044 CDS 100% 4.050 2.835 N Dnah8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523588.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.