Transcript: Mouse XM_006523669.3

PREDICTED: Mus musculus general transcription factor II H, polypeptide 4 (Gtf2h4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Gtf2h4 (14885)
Length:
1712
CDS:
221..1612

Additional Resources:

NCBI RefSeq record:
XM_006523669.3
NBCI Gene record:
Gtf2h4 (14885)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523669.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086047 GAGTGACTCTTTGTTGAACTT pLKO.1 985 CDS 100% 4.950 6.930 N Gtf2h4 n/a
2 TRCN0000316031 GAGTGACTCTTTGTTGAACTT pLKO_005 985 CDS 100% 4.950 6.930 N Gtf2h4 n/a
3 TRCN0000086045 CCAGTGATGCTCAAACAGAAT pLKO.1 1343 CDS 100% 4.950 3.465 N Gtf2h4 n/a
4 TRCN0000316032 CCAGTGATGCTCAAACAGAAT pLKO_005 1343 CDS 100% 4.950 3.465 N Gtf2h4 n/a
5 TRCN0000086044 CCCACCATAACAGACCAGATT pLKO.1 1376 CDS 100% 4.950 3.465 N Gtf2h4 n/a
6 TRCN0000086043 GCACACCTACAATGCAGGAAT pLKO.1 257 CDS 100% 4.950 3.465 N Gtf2h4 n/a
7 TRCN0000315958 GCACACCTACAATGCAGGAAT pLKO_005 257 CDS 100% 4.950 3.465 N Gtf2h4 n/a
8 TRCN0000146580 CAGCAGATAATCCATTTCCTA pLKO.1 1307 CDS 100% 3.000 2.100 N GTF2H4 n/a
9 TRCN0000086046 CGTCCTGTATAACCAGTTCCT pLKO.1 1441 CDS 100% 2.640 1.848 N Gtf2h4 n/a
10 TRCN0000349138 CGTCCTGTATAACCAGTTCCT pLKO_005 1441 CDS 100% 2.640 1.848 N Gtf2h4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523669.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.