Transcript: Mouse XM_006523686.2

PREDICTED: Mus musculus histocompatibility 2, O region beta locus (H2-Ob), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
H2-Ob (15002)
Length:
2611
CDS:
326..928

Additional Resources:

NCBI RefSeq record:
XM_006523686.2
NBCI Gene record:
H2-Ob (15002)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424944 CAACCGCAGTGAAGTATAAAT pLKO_005 1253 3UTR 100% 15.000 12.000 N H2-Ob n/a
2 TRCN0000067194 GCGGACTGTTACTTCACCAAT pLKO.1 227 5UTR 100% 4.950 3.960 N H2-Ob n/a
3 TRCN0000414725 ATGGATGGCTCAGTCTGAATA pLKO_005 751 CDS 100% 13.200 9.240 N H2-Ob n/a
4 TRCN0000067195 CCCTTCACTGTGGAGAGAAAT pLKO.1 452 CDS 100% 13.200 9.240 N H2-Ob n/a
5 TRCN0000067196 CTGGAAATGATCCCAGAGCTT pLKO.1 671 CDS 100% 2.640 1.848 N H2-Ob n/a
6 TRCN0000067197 GAGTCTCCATTCTCAACCCTA pLKO.1 907 CDS 100% 2.640 1.848 N H2-Ob n/a
7 TRCN0000067193 GCTGAGGATTCGGGTTGGCAA pLKO.1 979 3UTR 100% 0.880 0.616 N H2-Ob n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.