Transcript: Mouse XM_006523889.1

PREDICTED: Mus musculus RAB12, member RAS oncogene family (Rab12), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab12 (19328)
Length:
1723
CDS:
9..545

Additional Resources:

NCBI RefSeq record:
XM_006523889.1
NBCI Gene record:
Rab12 (19328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191725 GCGTAGTACTTCTAATACGAA pLKO.1 777 3UTR 100% 3.000 4.200 N Rab12 n/a
2 TRCN0000246403 TGGGTAAGGTCGGGTTATATA pLKO_005 689 3UTR 100% 15.000 12.000 N Rab12 n/a
3 TRCN0000246402 AGCATTACCTCAGCCTATTAC pLKO_005 126 CDS 100% 13.200 9.240 N Rab12 n/a
4 TRCN0000246406 TCAATGTGGACGAGATCTTTC pLKO_005 382 CDS 100% 10.800 7.560 N Rab12 n/a
5 TRCN0000246404 AGCAGGGCAGGAGCGATTTAA pLKO_005 104 CDS 100% 15.000 9.000 N Rab12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.