Transcript: Mouse XM_006524058.2

PREDICTED: Mus musculus widely-interspaced zinc finger motifs (Wiz), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wiz (22404)
Length:
4715
CDS:
400..3738

Additional Resources:

NCBI RefSeq record:
XM_006524058.2
NBCI Gene record:
Wiz (22404)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524058.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305321 GAAGAGTGGGTACGGCATTTA pLKO_005 3619 CDS 100% 13.200 18.480 N Wiz n/a
2 TRCN0000253786 AGCCCACAATGCCACGGAAAT pLKO_005 4300 3UTR 100% 10.800 7.560 N WIZ n/a
3 TRCN0000124556 CTGTGGTGAGTTCTTTGAGAA pLKO.1 1923 CDS 100% 4.950 3.465 N Wiz n/a
4 TRCN0000309309 CTGTGGTGAGTTCTTTGAGAA pLKO_005 1923 CDS 100% 4.950 3.465 N Wiz n/a
5 TRCN0000124555 GCAGGTTCTGTGAAGTGGAAT pLKO.1 3575 CDS 100% 4.950 3.465 N Wiz n/a
6 TRCN0000349240 GCAGGTTCTGTGAAGTGGAAT pLKO_005 3575 CDS 100% 4.950 3.465 N Wiz n/a
7 TRCN0000124554 GCTCCCTAGATCTTTCACTTT pLKO.1 4507 3UTR 100% 4.950 3.465 N Wiz n/a
8 TRCN0000309308 GCTCCCTAGATCTTTCACTTT pLKO_005 4507 3UTR 100% 4.950 3.465 N Wiz n/a
9 TRCN0000124558 CTGATCTTCACATCTCACCTT pLKO.1 2168 CDS 100% 2.640 1.848 N Wiz n/a
10 TRCN0000309307 CTGATCTTCACATCTCACCTT pLKO_005 2168 CDS 100% 2.640 1.848 N Wiz n/a
11 TRCN0000124557 CCTGGGCCAATCTACGGAGAT pLKO.1 796 CDS 100% 1.350 0.945 N Wiz n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524058.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.