Transcript: Mouse XM_006524136.1

PREDICTED: Mus musculus transmembrane protein 63b (Tmem63b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem63b (224807)
Length:
3345
CDS:
230..2728

Additional Resources:

NCBI RefSeq record:
XM_006524136.1
NBCI Gene record:
Tmem63b (224807)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366213 TTACAACGTGGCTCGACTTAT pLKO_005 1054 CDS 100% 13.200 18.480 N Tmem63b n/a
2 TRCN0000374734 ATCAATGGAATCTCCAAATAT pLKO_005 959 CDS 100% 15.000 12.000 N Tmem63b n/a
3 TRCN0000366212 CTGCTTTCATTAAGGTATTTA pLKO_005 2846 3UTR 100% 15.000 10.500 N Tmem63b n/a
4 TRCN0000374670 TGTGGCCAGGAAAGGGTTAAT pLKO_005 3009 3UTR 100% 13.200 9.240 N Tmem63b n/a
5 TRCN0000374671 TCTCCAGCTCTGTCGACTTTG pLKO_005 564 CDS 100% 10.800 7.560 N Tmem63b n/a
6 TRCN0000200900 CTGGACTTCATGTGCTTTCTT pLKO.1 368 CDS 100% 5.625 3.938 N Tmem63b n/a
7 TRCN0000155925 CCTGGTAGACAGGTACAATCT pLKO.1 2197 CDS 100% 4.950 3.465 N TMEM63B n/a
8 TRCN0000156236 CGTCTGCTTTGGACACTTCAA pLKO.1 2410 CDS 100% 4.950 3.465 N TMEM63B n/a
9 TRCN0000154771 GAGAACCACCATTGCCAACTT pLKO.1 802 CDS 100% 4.950 3.465 N TMEM63B n/a
10 TRCN0000193028 GCCAACTTGAAATCAGGGAAT pLKO.1 815 CDS 100% 4.050 2.835 N Tmem63b n/a
11 TRCN0000192306 CCTCAGAACATCTATTGGGAA pLKO.1 1472 CDS 100% 2.640 1.848 N Tmem63b n/a
12 TRCN0000151512 CCCTGCTTTCATTAAGGTATT pLKO.1 2844 3UTR 100% 10.800 6.480 N TMEM63B n/a
13 TRCN0000366152 TCTTCGTGAACTACGTCATTG pLKO_005 1932 CDS 100% 10.800 6.480 N Tmem63b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.