Transcript: Mouse XM_006524323.3

PREDICTED: Mus musculus signal peptide, CUB domain, EGF-like 3 (Scube3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scube3 (268935)
Length:
6959
CDS:
427..3456

Additional Resources:

NCBI RefSeq record:
XM_006524323.3
NBCI Gene record:
Scube3 (268935)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524323.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363053 TATAGACGAGTGCCGCTTAAA pLKO_005 1305 CDS 100% 13.200 18.480 N Scube3 n/a
2 TRCN0000363055 ACTAGCATCCATCGCTGTATC pLKO_005 2743 CDS 100% 10.800 15.120 N Scube3 n/a
3 TRCN0000363056 TGTACCTGCTACGACGGATTT pLKO_005 709 CDS 100% 10.800 15.120 N Scube3 n/a
4 TRCN0000363054 GTGTGGAAGGCACGGACAATT pLKO_005 524 CDS 100% 13.200 9.240 N Scube3 n/a
5 TRCN0000109649 TGGACGAATGTAGCATCAATA pLKO.1 1547 CDS 100% 13.200 9.240 N Scube3 n/a
6 TRCN0000109646 CTGTAAATTGACCTGCAACTA pLKO.1 1014 CDS 100% 4.950 3.465 N Scube3 n/a
7 TRCN0000055927 GCAGAGCTGTGTCAACATGAT pLKO.1 798 CDS 100% 4.950 3.465 N SCUBE3 n/a
8 TRCN0000109648 GATATAGACGAGTGCCGCTTA pLKO.1 1303 CDS 100% 4.050 2.835 N Scube3 n/a
9 TRCN0000109645 CCACTACTATAACACTAGCAT pLKO.1 2730 CDS 100% 3.000 2.100 N Scube3 n/a
10 TRCN0000109647 GCCAGATTTCCGTCAGAACTT pLKO.1 2787 CDS 100% 4.950 2.970 N Scube3 n/a
11 TRCN0000055924 GCTTCCAGATTCCCTATGTTA pLKO.1 3197 CDS 100% 5.625 3.938 N SCUBE3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524323.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.