Transcript: Mouse XM_006524425.2

PREDICTED: Mus musculus heparan sulfate (glucosamine) 3-O-sulfotransferase 6 (Hs3st6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hs3st6 (328779)
Length:
1365
CDS:
649..1257

Additional Resources:

NCBI RefSeq record:
XM_006524425.2
NBCI Gene record:
Hs3st6 (328779)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524425.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097962 CCCAGATACCAAGCTGATTGT pLKO.1 741 CDS 100% 4.950 6.930 N Hs3st6 n/a
2 TRCN0000097963 CTTCAATGCTACTAAGGGCTT pLKO.1 1065 CDS 100% 2.160 3.024 N Hs3st6 n/a
3 TRCN0000097961 CAGGACTTTCTGGGTCTCAAA pLKO.1 1018 CDS 100% 4.950 3.465 N Hs3st6 n/a
4 TRCN0000097960 CGCTCGTAGTTCTGTTGCTAA pLKO.1 234 5UTR 100% 4.950 3.465 N Hs3st6 n/a
5 TRCN0000097964 GCTCATTGTGGGTGTGAAGAA pLKO.1 415 5UTR 100% 4.950 3.465 N Hs3st6 n/a
6 TRCN0000034531 CCACTTCTTCGACAGGTGCTA pLKO.1 505 5UTR 100% 2.640 1.584 N LOC342460 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524425.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.