Transcript: Mouse XM_006524442.2

PREDICTED: Mus musculus triggering receptor expressed on myeloid cells-like 2 (Treml2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Treml2 (328833)
Length:
4568
CDS:
727..1539

Additional Resources:

NCBI RefSeq record:
XM_006524442.2
NBCI Gene record:
Treml2 (328833)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251519 TAGACCCAATGCCACTATAAA pLKO_005 4371 3UTR 100% 15.000 21.000 N Treml2 n/a
2 TRCN0000251518 TTGGGCAGCAACTATGCTAAA pLKO_005 1450 CDS 100% 10.800 15.120 N Treml2 n/a
3 TRCN0000265184 TCCGGACGATACTGGTGTATG pLKO_005 1039 CDS 100% 10.800 7.560 N Treml2 n/a
4 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 2359 3UTR 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.