Transcript: Mouse XM_006524526.1

PREDICTED: Mus musculus cyclin-dependent kinase-like 4 (Cdkl4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdkl4 (381113)
Length:
3031
CDS:
268..1296

Additional Resources:

NCBI RefSeq record:
XM_006524526.1
NBCI Gene record:
Cdkl4 (381113)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363390 TCGATCATCTTCCAAACATTT pLKO_005 1274 CDS 100% 13.200 18.480 N Cdkl4 n/a
2 TRCN0000368030 TTGTATTCATCGGGATGTAAA pLKO_005 630 CDS 100% 13.200 18.480 N Cdkl4 n/a
3 TRCN0000023278 CTGAAGATGATCGTGTCGTTA pLKO.1 380 CDS 100% 4.950 3.960 N Cdkl4 n/a
4 TRCN0000023277 CCAAGACACCAGTCTATCTTT pLKO.1 931 CDS 100% 5.625 3.938 N Cdkl4 n/a
5 TRCN0000023275 CGTATGCTGAAGCAGTTGAAA pLKO.1 424 CDS 100% 5.625 3.938 N Cdkl4 n/a
6 TRCN0000023276 CGAAAGAGATGCTTCCAGTTT pLKO.1 1498 3UTR 100% 4.950 3.465 N Cdkl4 n/a
7 TRCN0000023274 CGTTGTATTCAAGTGCAGAAA pLKO.1 315 CDS 100% 4.950 3.465 N Cdkl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.