Transcript: Mouse XM_006524596.3

PREDICTED: Mus musculus RAB44, member RAS oncogene family (Rab44), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab44 (442827)
Length:
3606
CDS:
445..2901

Additional Resources:

NCBI RefSeq record:
XM_006524596.3
NBCI Gene record:
Rab44 (442827)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524596.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102758 CGGTCACTTAAGATGCAAGAA pLKO.1 2809 CDS 100% 4.950 6.930 N Rab44 n/a
2 TRCN0000102757 CCTGAGCTGTTTGGGAATAAT pLKO.1 1063 CDS 100% 15.000 10.500 N Rab44 n/a
3 TRCN0000102755 GCGAGGACAATTCTCTATTTA pLKO.1 3400 3UTR 100% 15.000 10.500 N Rab44 n/a
4 TRCN0000102756 CCAGCCAAACAGTCCTTAGAA pLKO.1 1609 CDS 100% 5.625 3.938 N Rab44 n/a
5 TRCN0000102759 CCTCTACCATGTCGTCTTCTT pLKO.1 2331 CDS 100% 4.950 3.465 N Rab44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524596.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.