Transcript: Mouse XM_006524620.3

PREDICTED: Mus musculus proline-rich coiled-coil 2A (Prrc2a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prrc2a (53761)
Length:
6805
CDS:
151..6627

Additional Resources:

NCBI RefSeq record:
XM_006524620.3
NBCI Gene record:
Prrc2a (53761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524620.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257192 CCACCTTATCTGGCTAATTAT pLKO_005 2644 CDS 100% 15.000 21.000 N Prrc2a n/a
2 TRCN0000245345 TCGAAGAGCTGGGCCTATAAA pLKO_005 2985 CDS 100% 15.000 21.000 N Prrc2a n/a
3 TRCN0000099504 CCCATGAAGAGGTTGACTATA pLKO.1 1136 CDS 100% 13.200 18.480 N Prrc2a n/a
4 TRCN0000245344 CCCATGAAGAGGTTGACTATA pLKO_005 1136 CDS 100% 13.200 18.480 N Prrc2a n/a
5 TRCN0000099501 CCAAGTAAAGAACCTTTGAAA pLKO.1 3754 CDS 100% 5.625 4.500 N Prrc2a n/a
6 TRCN0000099503 GCCTCCAAGTAAAGAACCTTT pLKO.1 3750 CDS 100% 4.950 3.960 N Prrc2a n/a
7 TRCN0000245346 GGGCTTGTATATAGATTATAA pLKO_005 6655 3UTR 100% 15.000 10.500 N Prrc2a n/a
8 TRCN0000245343 CAACCTGTTTGATACGTATAA pLKO_005 210 CDS 100% 13.200 9.240 N Prrc2a n/a
9 TRCN0000184389 CCTCGCTCAACCTGTTTGATA pLKO.1 203 CDS 100% 5.625 3.938 N PRRC2A n/a
10 TRCN0000099500 GCCCATGAAGAGGTTGACTAT pLKO.1 1135 CDS 100% 4.950 3.465 N Prrc2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524620.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.