Transcript: Mouse XM_006524697.2

PREDICTED: Mus musculus WD repeat domain 46 (Wdr46), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdr46 (57315)
Length:
2206
CDS:
16..1926

Additional Resources:

NCBI RefSeq record:
XM_006524697.2
NBCI Gene record:
Wdr46 (57315)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524697.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248476 AGTAATGGCACAGTGTCTTTA pLKO_005 1063 CDS 100% 13.200 9.240 N Wdr46 n/a
2 TRCN0000248479 GGACCCTACAGACTGAATTAC pLKO_005 643 CDS 100% 13.200 9.240 N Wdr46 n/a
3 TRCN0000248480 ACCACCAGCTGAAGATCTTTG pLKO_005 1193 CDS 100% 10.800 7.560 N Wdr46 n/a
4 TRCN0000248478 CACAAAGATCCATAGGGAAAT pLKO_005 2107 3UTR 100% 10.800 7.560 N Wdr46 n/a
5 TRCN0000176156 GCACTGGATAGATTTGTACGA pLKO.1 1870 CDS 100% 2.640 1.848 N Wdr46 n/a
6 TRCN0000248477 TGGGTGATGTGGTCAACATAT pLKO_005 1310 CDS 100% 13.200 7.920 N Wdr46 n/a
7 TRCN0000175428 CCAGCTGAAGATCTTTGACTT pLKO.1 1197 CDS 100% 4.950 2.970 N Wdr46 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2054 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524697.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.