Transcript: Mouse XM_006524724.1

PREDICTED: Mus musculus WD repeat domain 4 (Wdr4), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdr4 (57773)
Length:
3625
CDS:
271..1209

Additional Resources:

NCBI RefSeq record:
XM_006524724.1
NBCI Gene record:
Wdr4 (57773)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524724.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217432 GCATAACTGTAACCCTAATAC pLKO.1 2056 3UTR 100% 13.200 18.480 N Wdr4 n/a
2 TRCN0000250200 AGCATAACTGTAACCCTAATA pLKO_005 2055 3UTR 100% 13.200 9.240 N Wdr4 n/a
3 TRCN0000258010 CTCCAAGTCTGGCCGCTATTT pLKO_005 232 5UTR 100% 13.200 9.240 N Wdr4 n/a
4 TRCN0000258006 TTTGACAACATGACCTCTTAC pLKO_005 1066 CDS 100% 10.800 7.560 N Wdr4 n/a
5 TRCN0000184216 GTCATCCTGAACTGCTGCTTT pLKO.1 569 CDS 100% 4.950 3.465 N Wdr4 n/a
6 TRCN0000179939 CAACATGACCTCTTACCTGAA pLKO.1 1071 CDS 100% 4.050 2.835 N Wdr4 n/a
7 TRCN0000257999 CCGCATAGCATCGAGTCTTTC pLKO_005 502 CDS 100% 10.800 6.480 N Wdr4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524724.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.