Transcript: Mouse XM_006524741.3

PREDICTED: Mus musculus contactin associated protein-like 5C (Cntnap5c), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cntnap5c (620292)
Length:
6644
CDS:
494..4414

Additional Resources:

NCBI RefSeq record:
XM_006524741.3
NBCI Gene record:
Cntnap5c (620292)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524741.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255271 TGGACAAACGATACTGGTTAT pLKO_005 2726 CDS 100% 10.800 15.120 N Cntnap5c n/a
2 TRCN0000255272 CGTAACTCAGATAATTATTAC pLKO_005 2770 CDS 100% 13.200 9.240 N Cntnap5c n/a
3 TRCN0000255273 AGCGTGAACCGCTCACAAATG pLKO_005 4167 CDS 100% 10.800 7.560 N Cntnap5c n/a
4 TRCN0000255269 AGTCCAATACAATCATATAAC pLKO_005 3994 CDS 100% 13.200 7.920 N Cntnap5c n/a
5 TRCN0000255270 GCCCTATGCCATGACCTTAAA pLKO_005 2443 CDS 100% 13.200 6.600 Y Cntnap5c n/a
6 TRCN0000086233 CCTTCCTTTCTTTCTTTCTTT pLKO.1 4483 3UTR 100% 5.625 2.813 Y Pou1f1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524741.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.