Transcript: Mouse XM_006524786.2

PREDICTED: Mus musculus lipin 2 (Lpin2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lpin2 (64898)
Length:
11685
CDS:
6139..8838

Additional Resources:

NCBI RefSeq record:
XM_006524786.2
NBCI Gene record:
Lpin2 (64898)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295631 ACCTCGTGATCCGGATATATA pLKO_005 7673 CDS 100% 15.000 21.000 N Lpin2 n/a
2 TRCN0000098248 GCGGCTCTCTATTTCCCTAAA pLKO.1 7393 CDS 100% 10.800 8.640 N Lpin2 n/a
3 TRCN0000298429 GCGGCTCTCTATTTCCCTAAA pLKO_005 7393 CDS 100% 10.800 8.640 N Lpin2 n/a
4 TRCN0000098246 GCCTCATAAGAGAAGTTGAAA pLKO.1 7073 CDS 100% 5.625 4.500 N Lpin2 n/a
5 TRCN0000098245 CCAACCATGTAATGCAGTCAT pLKO.1 9718 3UTR 100% 4.950 3.960 N Lpin2 n/a
6 TRCN0000288299 CCAACCATGTAATGCAGTCAT pLKO_005 9718 3UTR 100% 4.950 3.960 N Lpin2 n/a
7 TRCN0000098247 CCTTGGAATCAGAGGCAGTTT pLKO.1 6575 CDS 100% 4.950 3.465 N Lpin2 n/a
8 TRCN0000288298 CCTTGGAATCAGAGGCAGTTT pLKO_005 6575 CDS 100% 4.950 3.465 N Lpin2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.