Transcript: Mouse XM_006525032.3

PREDICTED: Mus musculus heat shock transcription factor 2 binding protein (Hsf2bp), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hsf2bp (74377)
Length:
2015
CDS:
309..1325

Additional Resources:

NCBI RefSeq record:
XM_006525032.3
NBCI Gene record:
Hsf2bp (74377)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525032.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239570 GACGACGGAAGTGATGCAAAT pLKO_005 413 CDS 100% 10.800 15.120 N Hsf2bp n/a
2 TRCN0000239566 TGCCGGAACATGGAATCTAAA pLKO_005 351 CDS 100% 13.200 10.560 N Hsf2bp n/a
3 TRCN0000017474 CGGGACTTCTTACCCAGAATA pLKO.1 435 CDS 100% 13.200 9.240 N HSF2BP n/a
4 TRCN0000239569 GGATGTCAAGGAGGTTGATTC pLKO_005 830 CDS 100% 10.800 7.560 N Hsf2bp n/a
5 TRCN0000239568 GTATAATGTGAGCATCAATTC pLKO_005 1031 CDS 100% 10.800 7.560 N Hsf2bp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525032.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.