Transcript: Mouse XM_006525080.3

PREDICTED: Mus musculus zinc ribbon domain containing 1, antisense (Znrd1as), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Znrd1as (76416)
Length:
1651
CDS:
554..1642

Additional Resources:

NCBI RefSeq record:
XM_006525080.3
NBCI Gene record:
Znrd1as (76416)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525080.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264896 TCCTGTACCAGTAGGATTAAA pLKO_005 1493 CDS 100% 15.000 21.000 N Znrd1as n/a
2 TRCN0000190931 CATCCTGTACCAGTAGGATTA pLKO.1 1491 CDS 100% 1.080 1.512 N Znrd1as n/a
3 TRCN0000264895 AGAGAGAACTGCTCCAAATTA pLKO_005 1302 CDS 100% 15.000 10.500 N Znrd1as n/a
4 TRCN0000264898 CAGCAGCAAGACACTTGATAA pLKO_005 882 CDS 100% 13.200 9.240 N Znrd1as n/a
5 TRCN0000283217 CTGCAAGGAGCAAGCTAATTC pLKO_005 934 CDS 100% 13.200 9.240 N Znrd1as n/a
6 TRCN0000264897 AGCAAATAGAAAGGCACATTC pLKO_005 1146 CDS 100% 10.800 7.560 N Znrd1as n/a
7 TRCN0000201176 GCCAGAGAATTTACAGACAAA pLKO.1 1181 CDS 100% 4.950 3.465 N Znrd1as n/a
8 TRCN0000190192 CCATCCTGTACCAGTAGGATT pLKO.1 1490 CDS 100% 0.495 0.347 N Znrd1as n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525080.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.