Transcript: Mouse XM_006525155.2

PREDICTED: Mus musculus echinoderm microtubule associated protein like 4 (Eml4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eml4 (78798)
Length:
5472
CDS:
279..3278

Additional Resources:

NCBI RefSeq record:
XM_006525155.2
NBCI Gene record:
Eml4 (78798)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525155.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432296 GGTGTTCATTTATGCGTTATT pLKO_005 1473 CDS 100% 13.200 18.480 N Eml4 n/a
2 TRCN0000438191 AGATAGCCGGAGTAGACAAAG pLKO_005 1327 CDS 100% 10.800 15.120 N Eml4 n/a
3 TRCN0000434777 ATCGCAGTGGCCGATGATTTC pLKO_005 2754 CDS 100% 10.800 15.120 N Eml4 n/a
4 TRCN0000428022 CCCAGACAATAAGCATATAAT pLKO_005 2534 CDS 100% 15.000 12.000 N Eml4 n/a
5 TRCN0000091469 CCTTCGGATGTTGACAACTAT pLKO.1 1065 CDS 100% 5.625 4.500 N Eml4 n/a
6 TRCN0000091470 CCTAATTTCAACTGGTGGGAA pLKO.1 2888 CDS 100% 2.640 2.112 N Eml4 n/a
7 TRCN0000091468 GCCTAAACATTCTGTAATGTT pLKO.1 4024 3UTR 100% 0.563 0.450 N Eml4 n/a
8 TRCN0000091471 CCTCAGTGGTAGTCCTGTTTA pLKO.1 1210 CDS 100% 13.200 9.240 N Eml4 n/a
9 TRCN0000412702 GTGTCCAAGAAATCCACATTT pLKO_005 3509 3UTR 100% 13.200 9.240 N Eml4 n/a
10 TRCN0000432546 TAACCAATGGAAGTGGTATAA pLKO_005 559 CDS 100% 13.200 9.240 N Eml4 n/a
11 TRCN0000416167 ACACTGTCCGCAGTCCGATAT pLKO_005 3395 3UTR 100% 10.800 7.560 N Eml4 n/a
12 TRCN0000418259 ATAAAGATGTCATCGTCAATC pLKO_005 955 CDS 100% 10.800 7.560 N Eml4 n/a
13 TRCN0000091472 CCGATCAGATTGCAAGGACAT pLKO.1 2621 CDS 100% 4.050 2.835 N Eml4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525155.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.