Transcript: Mouse XM_006525496.3

PREDICTED: Mus musculus malic enzyme 2, NAD(+)-dependent, mitochondrial (Me2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Me2 (107029)
Length:
7837
CDS:
377..2167

Additional Resources:

NCBI RefSeq record:
XM_006525496.3
NBCI Gene record:
Me2 (107029)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525496.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306435 TCAACGAGAGACCTATAATAT pLKO_005 1626 CDS 100% 15.000 21.000 N Me2 n/a
2 TRCN0000306436 CGACGGTACTGTCGCTGTTAA pLKO_005 2402 3UTR 100% 13.200 18.480 N Me2 n/a
3 TRCN0000114869 GCAGAGTACCTGTACGCTAAT pLKO.1 1988 CDS 100% 10.800 15.120 N Me2 n/a
4 TRCN0000332397 GCAGAGTACCTGTACGCTAAT pLKO_005 1988 CDS 100% 10.800 15.120 N Me2 n/a
5 TRCN0000114868 CCAATCTCATAGTTCTATCAA pLKO.1 1356 CDS 100% 5.625 7.875 N Me2 n/a
6 TRCN0000332396 CCAATCTCATAGTTCTATCAA pLKO_005 1356 CDS 100% 5.625 7.875 N Me2 n/a
7 TRCN0000114867 CGGAACACACTCATTCAGTTT pLKO.1 1139 CDS 100% 4.950 3.960 N Me2 n/a
8 TRCN0000332325 CGGAACACACTCATTCAGTTT pLKO_005 1139 CDS 100% 4.950 3.960 N Me2 n/a
9 TRCN0000114870 CCGGAACACACTCATTCAGTT pLKO.1 1138 CDS 100% 4.950 3.465 N Me2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525496.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.