Transcript: Mouse XM_006525639.4

PREDICTED: Mus musculus potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 (Kcnn2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Kcnn2 (140492)
Length:
2359
CDS:
59..2182

Additional Resources:

NCBI RefSeq record:
XM_006525639.4
NBCI Gene record:
Kcnn2 (140492)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525639.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069176 GCCGGAGCACAACAATTCTAA pLKO.1 1084 CDS 100% 5.625 7.875 N Kcnn2 n/a
2 TRCN0000069174 CGGAAATTCTTGCAAGCTATT pLKO.1 2334 3UTR 100% 10.800 7.560 N Kcnn2 n/a
3 TRCN0000043843 GCCATGACTTATGAGCGTATT pLKO.1 1490 CDS 100% 10.800 7.560 N KCNN2 n/a
4 TRCN0000069175 GCCAGAGTCATGCTATTACAT pLKO.1 1676 CDS 100% 5.625 3.938 N Kcnn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525639.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.