Transcript: Mouse XM_006525855.3

PREDICTED: Mus musculus family with sequence similarity 13, member B (Fam13b), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam13b (225358)
Length:
4682
CDS:
295..2415

Additional Resources:

NCBI RefSeq record:
XM_006525855.3
NBCI Gene record:
Fam13b (225358)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340836 AGCCAATCCGAAGGTATTAAA pLKO_005 2067 CDS 100% 15.000 21.000 N Fam13b n/a
2 TRCN0000047839 CGCCACGTTGTGGACTATATT pLKO.1 421 CDS 100% 15.000 21.000 N FAM13B n/a
3 TRCN0000230822 CGCCACGTTGTGGACTATATT pLKO_005 421 CDS 100% 15.000 21.000 N FAM13B n/a
4 TRCN0000352513 CGCCACGTTGTGGACTATATT pLKO_005 421 CDS 100% 15.000 21.000 N Fam13b n/a
5 TRCN0000340835 GTATTATCTCATCGTAGTTTA pLKO_005 1819 CDS 100% 13.200 18.480 N Fam13b n/a
6 TRCN0000340770 TAGTAGCAAGATACGTGATTT pLKO_005 1497 CDS 100% 13.200 18.480 N Fam13b n/a
7 TRCN0000340834 GCGTTGGATTTCTCGTCAAAG pLKO_005 1879 CDS 100% 10.800 15.120 N Fam13b n/a
8 TRCN0000173518 GAAAGAGAAGACGCCATCGAA pLKO.1 2262 CDS 100% 3.000 4.200 N Fam13b n/a
9 TRCN0000193971 GCTGATTACCAAACGGTTGAA pLKO.1 2298 CDS 100% 4.950 3.960 N Fam13b n/a
10 TRCN0000193396 CTCCAGTATTATCTCATCGTA pLKO.1 1814 CDS 100% 3.000 2.400 N Fam13b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.