Transcript: Mouse XM_006525866.3

PREDICTED: Mus musculus protein geranylgeranyltransferase type I, beta subunit (Pggt1b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pggt1b (225467)
Length:
7322
CDS:
382..1146

Additional Resources:

NCBI RefSeq record:
XM_006525866.3
NBCI Gene record:
Pggt1b (225467)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000345832 GACTATATGTTTGTAGGTTAT pLKO_005 1405 3UTR 100% 10.800 15.120 N Pggt1b n/a
2 TRCN0000265281 GCGCATCCTGCATTTGCTATA pLKO_005 542 CDS 100% 10.800 15.120 N Pggt1b n/a
3 TRCN0000345859 TGGTGAACAAAGACGATATAA pLKO_005 205 5UTR 100% 15.000 10.500 N Pggt1b n/a
4 TRCN0000345937 CTTACGACAGTGGACACATAG pLKO_005 359 5UTR 100% 10.800 7.560 N Pggt1b n/a
5 TRCN0000215475 GAATAGGAACTACATCTTATC pLKO.1 891 CDS 100% 10.800 7.560 N Pggt1b n/a
6 TRCN0000190276 CCTTACGACAGTGGACACATA pLKO.1 358 5UTR 100% 4.950 3.465 N Pggt1b n/a
7 TRCN0000201127 CGCTCTCTAGAGAAAGACATT pLKO.1 1918 3UTR 100% 4.950 3.465 N Pggt1b n/a
8 TRCN0000201501 CAGGATAAAGAGGTGGTGCAT pLKO.1 750 CDS 100% 2.640 1.848 N Pggt1b n/a
9 TRCN0000265307 CACTGTGCCTGATGGGTAAAC pLKO_005 698 CDS 100% 10.800 6.480 N Pggt1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.