Transcript: Mouse XM_006525993.3

PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X18, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bin1 (30948)
Length:
2012
CDS:
210..1514

Additional Resources:

NCBI RefSeq record:
XM_006525993.3
NBCI Gene record:
Bin1 (30948)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525993.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088190 CCTGATATCAAGTCGCGCATT pLKO.1 609 CDS 100% 4.050 5.670 N Bin1 n/a
2 TRCN0000088189 CCGGGATTCATGTTCAAGGTT pLKO.1 1287 CDS 100% 3.000 4.200 N Bin1 n/a
3 TRCN0000238136 GACCTATCTGGCTTCTGTTAA pLKO_005 407 CDS 100% 13.200 9.240 N Bin1 n/a
4 TRCN0000257035 AGACGAAGGACGAGCAGTTTG pLKO_005 322 CDS 100% 10.800 7.560 N Bin1 n/a
5 TRCN0000380702 AGCTCAATCAGAACCTCAATG pLKO_005 889 CDS 100% 10.800 7.560 N Bin1 n/a
6 TRCN0000380439 CTGATGAGCTGCAACTCAAAG pLKO_005 1339 CDS 100% 10.800 7.560 N Bin1 n/a
7 TRCN0000257057 GCGATGTGGTGTTGGTGATTC pLKO_005 1363 CDS 100% 10.800 7.560 N Bin1 n/a
8 TRCN0000238138 CCCGAGTGTGAAGAACCTTTC pLKO_005 1527 3UTR 100% 6.000 4.200 N Bin1 n/a
9 TRCN0000088191 ACTTCCATAAAGAGATGAGTA pLKO.1 868 CDS 100% 4.950 3.465 N Bin1 n/a
10 TRCN0000088188 GAAACCTAAGCCAAGAGGTAT pLKO.1 1649 3UTR 100% 4.950 3.465 N Bin1 n/a
11 TRCN0000379747 TCAGTGGACTTCTCCAGTGTT pLKO_005 1715 3UTR 100% 4.950 3.465 N Bin1 n/a
12 TRCN0000382367 TCAAAGCCCAGAAGGTGTTTG pLKO_005 745 CDS 100% 10.800 15.120 N BIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525993.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.