Transcript: Mouse XM_006526013.3

PREDICTED: Mus musculus O-acyltransferase like (Oacyl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Oacyl (319888)
Length:
3613
CDS:
452..2179

Additional Resources:

NCBI RefSeq record:
XM_006526013.3
NBCI Gene record:
Oacyl (319888)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526013.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080007 GTTCAGAAACACGTCATTCTT pLKO.1 499 CDS 100% 5.625 7.875 N Oacyl n/a
2 TRCN0000080003 CGTTGTAGACAGATAACCTTT pLKO.1 2293 3UTR 100% 4.950 6.930 N Oacyl n/a
3 TRCN0000080006 GACACCAACATGCTCTATCTT pLKO.1 2042 CDS 100% 5.625 4.500 N Oacyl n/a
4 TRCN0000446658 GTGGTTCTTGGAACGTGAATC pLKO_005 2247 3UTR 100% 10.800 7.560 N Oacyl n/a
5 TRCN0000080005 CCACCCTACAGACATTCTCAA pLKO.1 1696 CDS 100% 4.950 3.465 N Oacyl n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3206 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526013.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.