Transcript: Mouse XM_006526101.3

PREDICTED: Mus musculus polycystic kidney disease 2-like 2 (Pkd2l2), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pkd2l2 (53871)
Length:
2009
CDS:
311..1879

Additional Resources:

NCBI RefSeq record:
XM_006526101.3
NBCI Gene record:
Pkd2l2 (53871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526101.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097786 CGAGTTTAAGTCTGCCTATTT pLKO.1 1231 CDS 100% 13.200 10.560 N Pkd2l2 n/a
2 TRCN0000097787 CCTTGCATACTGGCACATTTA pLKO.1 1396 CDS 100% 13.200 9.240 N Pkd2l2 n/a
3 TRCN0000097789 CTGGCAGTTCTACTCTGTGAA pLKO.1 1105 CDS 100% 4.950 3.465 N Pkd2l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526101.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.