Transcript: Mouse XM_006526112.3

PREDICTED: Mus musculus transcription elongation regulator 1 (CA150) (Tcerg1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tcerg1 (56070)
Length:
4664
CDS:
458..3778

Additional Resources:

NCBI RefSeq record:
XM_006526112.3
NBCI Gene record:
Tcerg1 (56070)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526112.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085846 GCGGAAGAGAGATGATAATAA pLKO.1 2362 CDS 100% 15.000 21.000 N Tcerg1 n/a
2 TRCN0000218000 AGGTGTAGCAATGATGCAAAT pLKO_005 1615 CDS 100% 10.800 15.120 N TCERG1 n/a
3 TRCN0000085844 CCCGATATAAAGCGGTGGATA pLKO.1 2955 CDS 100% 4.950 6.930 N Tcerg1 n/a
4 TRCN0000014939 GCCAAGAATTTAGACTCAGAA pLKO.1 3023 CDS 100% 4.950 6.930 N TCERG1 n/a
5 TRCN0000413858 GTTCTCAATGAGCGCAATTAA pLKO_005 2284 CDS 100% 15.000 12.000 N Tcerg1 n/a
6 TRCN0000085845 CCTCGGTACTTGCTTCTCAAT pLKO.1 2555 CDS 100% 4.950 3.960 N Tcerg1 n/a
7 TRCN0000429707 GAATGAAGATGAGCCTATTAA pLKO_005 2332 CDS 100% 15.000 10.500 N Tcerg1 n/a
8 TRCN0000427076 AGTTGCACAAGATAGTATTTG pLKO_005 2532 CDS 100% 13.200 9.240 N Tcerg1 n/a
9 TRCN0000085847 GCAGTTTCTGAGTGGACTGAA pLKO.1 1772 CDS 100% 4.950 3.465 N Tcerg1 n/a
10 TRCN0000085843 GCCTATGTTGATGACCTGGAT pLKO.1 3698 CDS 100% 2.640 1.848 N Tcerg1 n/a
11 TRCN0000230333 TACCACCAAGACCGGTGTATT pLKO_005 1666 CDS 100% 0.000 0.000 N TCERG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526112.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.