Transcript: Mouse XM_006526162.2

PREDICTED: Mus musculus zinc finger protein 474 (Zfp474), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp474 (66758)
Length:
1996
CDS:
441..1484

Additional Resources:

NCBI RefSeq record:
XM_006526162.2
NBCI Gene record:
Zfp474 (66758)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194553 GCTATATTTGTGGCCGAGAAT pLKO.1 721 CDS 100% 4.950 6.930 N Zfp474 n/a
2 TRCN0000173882 GAAAGGAAAGGCGGTCCAAAT pLKO.1 1392 CDS 100% 10.800 7.560 N Zfp474 n/a
3 TRCN0000215418 GACTCTCATCTGTTACATTTG pLKO.1 1091 CDS 100% 10.800 7.560 N Zfp474 n/a
4 TRCN0000175013 GCCAATGTTTATTGCTGGTTT pLKO.1 1844 3UTR 100% 4.950 3.465 N Zfp474 n/a
5 TRCN0000174751 GAAGTTGTAAATCTCAACCTA pLKO.1 1342 CDS 100% 3.000 2.100 N Zfp474 n/a
6 TRCN0000173889 GCAGCCAATGAGGAAGCATTT pLKO.1 885 CDS 100% 10.800 6.480 N Zfp474 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.