Transcript: Mouse XM_006526248.3

PREDICTED: Mus musculus spermatogenesis associated 24 (Spata24), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spata24 (71242)
Length:
581
CDS:
16..555

Additional Resources:

NCBI RefSeq record:
XM_006526248.3
NBCI Gene record:
Spata24 (71242)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526248.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192828 GCCAAGGAAGAAGAGAAGTTA pLKO.1 160 CDS 100% 5.625 3.938 N Spata24 n/a
2 TRCN0000192589 GAAAGAGAAGATGGCCTTTGA pLKO.1 225 CDS 100% 4.950 3.465 N Spata24 n/a
3 TRCN0000268621 ATGGCAAAGAGAATGAGATTA pLKO_005 362 CDS 100% 13.200 7.920 N SPATA24 n/a
4 TRCN0000201737 GCAGCTGGAGAAAGAGAAGAT pLKO.1 216 CDS 100% 4.950 2.970 N Spata24 n/a
5 TRCN0000191766 GAAATAGAGAAGAAACTGGTG pLKO.1 100 CDS 100% 2.160 1.296 N Spata24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526248.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.