Transcript: Mouse XM_006526343.3

PREDICTED: Mus musculus DnaJ heat shock protein family (Hsp40) member C18 (Dnajc18), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dnajc18 (76594)
Length:
5297
CDS:
208..1281

Additional Resources:

NCBI RefSeq record:
XM_006526343.3
NBCI Gene record:
Dnajc18 (76594)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526343.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294855 ACAGTTCAGTGTTATCCAAAT pLKO_005 1737 3UTR 100% 10.800 15.120 N Dnajc18 n/a
2 TRCN0000039178 CCCATATAGTCTGTTCTATAA pLKO.1 960 CDS 100% 1.320 1.848 N Dnajc18 n/a
3 TRCN0000287364 CCCATATAGTCTGTTCTATAA pLKO_005 960 CDS 100% 1.320 1.848 N Dnajc18 n/a
4 TRCN0000294854 TCGAGCCAGATCTTATCATTA pLKO_005 672 CDS 100% 13.200 9.240 N Dnajc18 n/a
5 TRCN0000039177 CCAAGCTTACATTGATGCAAT pLKO.1 243 CDS 100% 4.950 3.465 N Dnajc18 n/a
6 TRCN0000039176 CCTGGAGAAGACAATAGAGAA pLKO.1 1086 CDS 100% 4.950 3.465 N Dnajc18 n/a
7 TRCN0000287363 CCTGGAGAAGACAATAGAGAA pLKO_005 1086 CDS 100% 4.950 3.465 N Dnajc18 n/a
8 TRCN0000039175 CGCTATGATGAATATGGAGAT pLKO.1 628 CDS 100% 4.050 2.835 N Dnajc18 n/a
9 TRCN0000287362 CGCTATGATGAATATGGAGAT pLKO_005 628 CDS 100% 4.050 2.835 N Dnajc18 n/a
10 TRCN0000039174 GCCTCTTGAGAGCTGTGATTT pLKO.1 1902 3UTR 100% 13.200 7.920 N Dnajc18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526343.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.