Transcript: Mouse XM_006526367.3

PREDICTED: Mus musculus endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae) (Sil1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sil1 (81500)
Length:
1677
CDS:
510..1304

Additional Resources:

NCBI RefSeq record:
XM_006526367.3
NBCI Gene record:
Sil1 (81500)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526367.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248656 GATTATGGTTCGGCTGATAAA pLKO_005 1070 CDS 100% 13.200 18.480 N Sil1 n/a
2 TRCN0000248659 GGCCTTCAAGTGGTGATTAAT pLKO_005 1200 CDS 100% 15.000 12.000 N Sil1 n/a
3 TRCN0000248660 CAAGAGTGCGCTGGCCAAATT pLKO_005 914 CDS 100% 13.200 10.560 N Sil1 n/a
4 TRCN0000191112 GATCTTGAGTACTATGTCCAT pLKO.1 1143 CDS 100% 2.640 2.112 N Sil1 n/a
5 TRCN0000248658 CAGCTGTCAGAACTCAAATAA pLKO_005 599 CDS 100% 15.000 10.500 N Sil1 n/a
6 TRCN0000248657 AGAAGGTTGCTGCGCTCTTTG pLKO_005 1123 CDS 100% 10.800 7.560 N Sil1 n/a
7 TRCN0000201148 CCACCAGGAATCAGATACAAA pLKO.1 650 CDS 100% 5.625 3.938 N Sil1 n/a
8 TRCN0000190620 GCAGATTATGGTTCGGCTGAT pLKO.1 1067 CDS 100% 4.050 2.835 N Sil1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526367.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.