Transcript: Mouse XM_006526483.3

PREDICTED: Mus musculus neuropilin (NRP) and tolloid (TLL)-like 1 (Neto1), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Neto1 (246317)
Length:
7031
CDS:
1462..2475

Additional Resources:

NCBI RefSeq record:
XM_006526483.3
NBCI Gene record:
Neto1 (246317)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526483.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087561 CGAGAGTGTGTCTACATCATA pLKO.1 1239 5UTR 100% 5.625 3.938 N Neto1 n/a
2 TRCN0000063556 GCAACCAAGAAAGGAACAGAA pLKO.1 1107 5UTR 100% 4.950 3.465 N NETO1 n/a
3 TRCN0000063557 TCTGCCTCATTGGGTCTCTAA pLKO.1 2417 CDS 100% 4.950 3.465 N NETO1 n/a
4 TRCN0000087560 GCAAGTTTAATCATCCTCCAT pLKO.1 1077 5UTR 100% 2.640 1.848 N Neto1 n/a
5 TRCN0000087562 GTCTCCCAATTATCCCAGCAA pLKO.1 1205 5UTR 100% 2.640 1.848 N Neto1 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4375 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526483.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.