Transcript: Mouse XM_006526582.3

PREDICTED: Mus musculus golgi-specific brefeldin A-resistance factor 1 (Gbf1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gbf1 (107338)
Length:
6417
CDS:
274..5847

Additional Resources:

NCBI RefSeq record:
XM_006526582.3
NBCI Gene record:
Gbf1 (107338)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526582.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306494 ACTATGATTGTGACTACTATT pLKO_005 1895 CDS 100% 13.200 18.480 N Gbf1 n/a
2 TRCN0000376230 ATGAGATGTGCCGACACTTAT pLKO_005 1637 CDS 100% 13.200 18.480 N Gbf1 n/a
3 TRCN0000109968 CCACGGGAACTAATTGAAATT pLKO.1 2341 CDS 100% 13.200 18.480 N Gbf1 n/a
4 TRCN0000326913 CCACGGGAACTAATTGAAATT pLKO_005 2341 CDS 100% 13.200 18.480 N Gbf1 n/a
5 TRCN0000158157 CCATCAAACGAAATGCCCGAT pLKO.1 329 CDS 100% 2.160 3.024 N GBF1 n/a
6 TRCN0000109966 CGACACTAAGTCCCTGCTTAA pLKO.1 4431 CDS 100% 10.800 8.640 N Gbf1 n/a
7 TRCN0000109969 GCACTCATAGATCCAACTCAT pLKO.1 559 CDS 100% 4.950 3.960 N Gbf1 n/a
8 TRCN0000311559 TGATGGACACAGCGGAGATTT pLKO_005 5297 CDS 100% 13.200 9.240 N Gbf1 n/a
9 TRCN0000376229 TGCACTTTGTTCCTCTCTATC pLKO_005 6203 3UTR 100% 10.800 7.560 N Gbf1 n/a
10 TRCN0000109965 CGCCTCCAATTCTTCTTCCTT pLKO.1 6247 3UTR 100% 3.000 2.100 N Gbf1 n/a
11 TRCN0000156557 GCAGCCAAGACAGTATTCCAT pLKO.1 3295 CDS 100% 3.000 2.100 N GBF1 n/a
12 TRCN0000109967 GCACAGTTTCAGTAACCTGAA pLKO.1 393 CDS 100% 0.405 0.284 N Gbf1 n/a
13 TRCN0000326912 GCACAGTTTCAGTAACCTGAA pLKO_005 393 CDS 100% 0.405 0.284 N Gbf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526582.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.