Transcript: Mouse XM_006526721.1

PREDICTED: Mus musculus potassium channel, subfamily K, member 4 (Kcnk4), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnk4 (16528)
Length:
2249
CDS:
765..1928

Additional Resources:

NCBI RefSeq record:
XM_006526721.1
NBCI Gene record:
Kcnk4 (16528)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419272 TGTAGGCTTTGGCGATTATGT pLKO_005 1370 CDS 100% 5.625 7.875 N Kcnk4 n/a
2 TRCN0000418626 ATCTGGCCTTCATCGACGAGT pLKO_005 1774 CDS 100% 2.640 3.696 N Kcnk4 n/a
3 TRCN0000069979 GAAGCCATCTACTTTGTTATA pLKO.1 1335 CDS 100% 13.200 9.240 N Kcnk4 n/a
4 TRCN0000069978 TGCTTGGCTTATTTGACCAAA pLKO.1 1990 3UTR 100% 4.950 3.465 N Kcnk4 n/a
5 TRCN0000069981 TGGTGCTGCTTTACTTGGTAT pLKO.1 893 CDS 100% 4.950 3.465 N Kcnk4 n/a
6 TRCN0000069980 GCAATCTTCTTGAAGTGGCAT pLKO.1 1197 CDS 100% 2.640 1.848 N Kcnk4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.