Transcript: Mouse XM_006526748.3

PREDICTED: Mus musculus nebulin-related anchoring protein (Nrap), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nrap (18175)
Length:
5330
CDS:
337..5172

Additional Resources:

NCBI RefSeq record:
XM_006526748.3
NBCI Gene record:
Nrap (18175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424615 ATCAGCGAGACTCGCTATAAG pLKO_005 3046 CDS 100% 13.200 18.480 N Nrap n/a
2 TRCN0000418053 CGTCTACCACACACCCTTAAA pLKO_005 288 5UTR 100% 13.200 18.480 N Nrap n/a
3 TRCN0000430805 GAGCTCATCAGCGAGAGTAAA pLKO_005 3565 CDS 100% 13.200 10.560 N Nrap n/a
4 TRCN0000431949 AGCTTGCTAGCAGCGTTAAAT pLKO_005 1703 CDS 100% 15.000 10.500 N Nrap n/a
5 TRCN0000012189 GCTTTGAAGTTTACCAGTATT pLKO.1 2875 CDS 100% 13.200 9.240 N Nrap n/a
6 TRCN0000012192 GCCAGTGATTTCCGGTACAAA pLKO.1 4612 CDS 100% 5.625 3.938 N Nrap n/a
7 TRCN0000012190 CGAGAGAAACAAGCTGAACTA pLKO.1 1524 CDS 100% 4.950 3.465 N Nrap n/a
8 TRCN0000012188 CCAGCTTATCAGATAGCCAAA pLKO.1 823 CDS 100% 4.050 2.835 N Nrap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.