Transcript: Mouse XM_006526847.1

PREDICTED: Mus musculus TBC1D12: TBC1 domain family, member 12 (Tbc1d12), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d12 (209478)
Length:
3281
CDS:
146..1555

Additional Resources:

NCBI RefSeq record:
XM_006526847.1
NBCI Gene record:
Tbc1d12 (209478)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526847.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215892 CTTCATTTCAAGTCGTATAAT pLKO.1 1178 CDS 100% 15.000 21.000 N Tbc1d12 n/a
2 TRCN0000216124 CAATGGTAATTTGGATCAATG pLKO.1 594 CDS 100% 10.800 8.640 N Tbc1d12 n/a
3 TRCN0000193341 CTCCTACAGATGGACTTTATT pLKO.1 1358 CDS 100% 15.000 10.500 N Tbc1d12 n/a
4 TRCN0000193421 CTACAGATGGACTTTATTCAT pLKO.1 1361 CDS 100% 5.625 3.938 N Tbc1d12 n/a
5 TRCN0000176060 GATGCAGAATAGCACCAAGAA pLKO.1 1456 CDS 100% 4.950 3.465 N Tbc1d12 n/a
6 TRCN0000175163 GCCAGAAGATATAACATCAGA pLKO.1 1405 CDS 100% 3.000 2.100 N Tbc1d12 n/a
7 TRCN0000173220 CACCAAGAAATGGACTCAGGT pLKO.1 1468 CDS 100% 2.640 1.848 N Tbc1d12 n/a
8 TRCN0000194065 GCATCTGTAGCAAAGGACATT pLKO.1 1493 CDS 100% 4.950 2.970 N Tbc1d12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526847.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.