Transcript: Mouse XM_006526908.3

PREDICTED: Mus musculus tight junction protein 2 (Tjp2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tjp2 (21873)
Length:
4692
CDS:
410..3913

Additional Resources:

NCBI RefSeq record:
XM_006526908.3
NBCI Gene record:
Tjp2 (21873)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526908.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421477 AGAATGCGAGGATCGAAATAG pLKO_005 3651 CDS 100% 13.200 18.480 N Tjp2 n/a
2 TRCN0000417006 GAAACGACGTTGGGATATTTG pLKO_005 1932 CDS 100% 13.200 18.480 N Tjp2 n/a
3 TRCN0000091772 CTTCGACTACTCCAAGTCAAA pLKO.1 3373 CDS 100% 4.950 6.930 N Tjp2 n/a
4 TRCN0000091770 CGCTCCTATCACGAAGCTTAT pLKO.1 1079 CDS 100% 10.800 8.640 N Tjp2 n/a
5 TRCN0000091769 CGGCACTGTTACTGAGAACAT pLKO.1 1411 CDS 100% 4.950 3.960 N Tjp2 n/a
6 TRCN0000436114 AGATGTGAAGAGGGAGTTAAA pLKO_005 4219 3UTR 100% 13.200 9.240 N Tjp2 n/a
7 TRCN0000428260 GATTCCAGACAAGGTGTTAAA pLKO_005 2801 CDS 100% 13.200 9.240 N Tjp2 n/a
8 TRCN0000425618 GCTTCATGCAAACCCATAATG pLKO_005 4349 3UTR 100% 13.200 9.240 N Tjp2 n/a
9 TRCN0000091771 GCCTACACTGACAATGAGCTA pLKO.1 3146 CDS 100% 2.640 1.848 N Tjp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526908.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.