Transcript: Mouse XM_006526916.1

PREDICTED: Mus musculus ventral anterior homeobox 1 (Vax1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vax1 (22326)
Length:
3152
CDS:
777..1445

Additional Resources:

NCBI RefSeq record:
XM_006526916.1
NBCI Gene record:
Vax1 (22326)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070857 TCGGCGGACTAAGCAGAAGAA pLKO.1 878 CDS 100% 4.950 6.930 N Vax1 n/a
2 TRCN0000070854 CCGAGAAATCATCCTGCCCAA pLKO.1 686 5UTR 100% 2.160 1.512 N Vax1 n/a
3 TRCN0000070856 GCTCAATCTCTCTGAGACCCA pLKO.1 836 CDS 100% 0.660 0.462 N Vax1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.