Transcript: Mouse XM_006527018.2

PREDICTED: Mus musculus pleckstrin homology domain containing, family S member 1 (Plekhs1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plekhs1 (226245)
Length:
2975
CDS:
673..2097

Additional Resources:

NCBI RefSeq record:
XM_006527018.2
NBCI Gene record:
Plekhs1 (226245)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012202 CGCCTCACTAACTGTTGTGAA pLKO.1 1641 CDS 100% 4.950 6.930 N Plekhs1 n/a
2 TRCN0000422539 CCATACTGCCAGGGTGTTAAA pLKO_005 1066 CDS 100% 13.200 10.560 N Plekhs1 n/a
3 TRCN0000423336 AGTAAATCCCTGGTCTAATTA pLKO_005 2302 3UTR 100% 15.000 10.500 N Plekhs1 n/a
4 TRCN0000012201 CCACTGTAGAAGTTGGTATAA pLKO.1 902 CDS 100% 13.200 9.240 N Plekhs1 n/a
5 TRCN0000012198 CCCACATGAAATAATGACTAA pLKO.1 2215 3UTR 100% 4.950 3.465 N Plekhs1 n/a
6 TRCN0000012200 CCCACCCAAGATACAGAAGAA pLKO.1 1294 CDS 100% 4.950 3.465 N Plekhs1 n/a
7 TRCN0000012199 GCCTGTTTAGAATTAGAGAAT pLKO.1 1345 CDS 100% 4.950 3.465 N Plekhs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.