Transcript: Mouse XM_006527090.1

PREDICTED: Mus musculus von Willebrand factor A domain containing 2 (Vwa2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vwa2 (240675)
Length:
3276
CDS:
108..1943

Additional Resources:

NCBI RefSeq record:
XM_006527090.1
NBCI Gene record:
Vwa2 (240675)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527090.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437824 CGACTACTGCGTCAGCATTTA pLKO_005 2037 3UTR 100% 13.200 18.480 N Vwa2 n/a
2 TRCN0000415997 ACGTGAGAACTTTGCCCAAAT pLKO_005 1193 CDS 100% 10.800 15.120 N Vwa2 n/a
3 TRCN0000443491 GAGGTAAGCTGCCTGTCATTT pLKO_005 2084 3UTR 100% 13.200 9.240 N Vwa2 n/a
4 TRCN0000412667 TTTGACCAATTACTCAGTTTG pLKO_005 2375 3UTR 100% 10.800 7.560 N Vwa2 n/a
5 TRCN0000090168 CCCAGGAGGTTTGCTTTCAAA pLKO.1 2580 3UTR 100% 5.625 3.938 N Vwa2 n/a
6 TRCN0000090171 GCCAGTTATGGCAGGAATCTA pLKO.1 717 CDS 100% 5.625 3.938 N Vwa2 n/a
7 TRCN0000090169 GCATTCCAGAAGGTGTGGATA pLKO.1 493 CDS 100% 4.950 3.465 N Vwa2 n/a
8 TRCN0000090172 CGGTTTGATGTGAATCCTGAT pLKO.1 1242 CDS 100% 4.050 2.835 N Vwa2 n/a
9 TRCN0000090170 CCAAGCATCTTAGAATCGGAA pLKO.1 1900 CDS 100% 2.640 1.848 N Vwa2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527090.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.