Transcript: Mouse XM_006527216.1

PREDICTED: Mus musculus DNA cross-link repair 1A (Dclre1a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dclre1a (55947)
Length:
4193
CDS:
709..3852

Additional Resources:

NCBI RefSeq record:
XM_006527216.1
NBCI Gene record:
Dclre1a (55947)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527216.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125969 GCGGCGATAATGAAATCTAAA pLKO.1 3889 3UTR 100% 13.200 18.480 N Dclre1a n/a
2 TRCN0000325658 GCGGCGATAATGAAATCTAAA pLKO_005 3889 3UTR 100% 13.200 18.480 N Dclre1a n/a
3 TRCN0000125972 CCAGTCTATTGCAGCGAGATA pLKO.1 2971 CDS 100% 4.950 6.930 N Dclre1a n/a
4 TRCN0000287654 CCAGTCTATTGCAGCGAGATA pLKO_005 2971 CDS 100% 4.950 6.930 N Dclre1a n/a
5 TRCN0000125970 GCGCCCTGTTTATGATGGATA pLKO.1 1104 CDS 100% 4.950 3.960 N Dclre1a n/a
6 TRCN0000287653 GCGCCCTGTTTATGATGGATA pLKO_005 1104 CDS 100% 4.950 3.960 N Dclre1a n/a
7 TRCN0000125973 CCAACCGTCTAAGAAAGTAAT pLKO.1 2373 CDS 100% 13.200 9.240 N Dclre1a n/a
8 TRCN0000287652 CCAACCGTCTAAGAAAGTAAT pLKO_005 2373 CDS 100% 13.200 9.240 N Dclre1a n/a
9 TRCN0000295010 CCTCGCTTTGAACAGTGATAC pLKO_005 3961 3UTR 100% 10.800 7.560 N Dclre1a n/a
10 TRCN0000125971 GCTGAAATCAACAGGAAGAAT pLKO.1 1489 CDS 100% 5.625 3.938 N Dclre1a n/a
11 TRCN0000287657 GCTGAAATCAACAGGAAGAAT pLKO_005 1489 CDS 100% 5.625 3.938 N Dclre1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527216.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.